Carl-Gustaf Brylé

Från Psyklopedin
Hoppa till: navigering, psyka

Carl-Gustaf Brylé, 1910—1993, var en svensk prisbelönt kock, främst berömd för sin internationellt erkända uppfinning Brylé-puddingen. Tvärtemot en vanlig föreställning är denna frejdade maträtt döpt efter Brylés fru, Asta-Agda, av orsaker som vi inte närmare känner till. Det är också Carl-Gustaf Brylé som uppfann den svenska blodpuddingen, svenska studenters favoriträtt, samt den norrländska pölsan och pite-palten, samt ett antal maträtter som givit den i övrigt kulturlösa Norrländska landsdelen en sann kultur.

Personligt liv[redigera]

Carl-Gustaf Brylé föddes i en Stockholmsk borgerlig familj år 1910, son till Bert-August Brylé och Petronella Brylé, född Lindström av den berömda biffen. Carl-Gustaf var alltså genom moderssidan släkt med den berömde Bertil Lindström, skapare av den internationellt erkända biffen. Bert-August Brylé var i sin tur uppfinnare av den varma korven med senap och ketchup, en helsvensk kulturell egenhet som saknar varje internationellt jämförbar konkurrent, även om den barbariskt osvenska hamburgaren infiltrerat fosterlandet med kött av gammal (s)ko.

Redan som en liten pojke visade sig Carl-Gustafs arvsanlag, den moderna genetikern Joseph Smith Jr. har identifierat kock-arvsanlagen såsom liggande på kromosom 3, kodat som ACCACGTGGAAGAAGAGAAACCATGCAACGTCGATA på gen 13644 precis invid arvsanlagen för modellflygplan och skonummer 43 för herrar och 37 för damer. Carl-Gustaf började alltså sin karriär med att leka kock med lera, jord och löv i leksakskastruller vid leksaksspisen, där han komponerade lerbiff med jordmos, lövbiff med lerpudding, jordbacon med lerägg och lövsallad med jordkrydda.

När Carl-Gustaf växte upp var spisen favorittillhåll, gärna i sällskap med mamma Petronella, men även när pappa Bert-August gjorde dramatiska kockföreställningar och sjöng arior av Wagner samtidigt som han komponerade Mannagrynsgröt á la Bert-August, som serverades på familjen Brylés restauranger vid frukost. Det var också bakom spisen som Carl-Gustaf mötte sin fru Asta-Agda, född Jansson af den Berömda Frestelsen, som vid tillfället var servitris på en av pappas restauranger, men som snabbt arbetade upp sig till bikock därefter huvudkock de Luxe på grund av sitt släktskap och sin naturliga begåvning, i detta fall en specialvariant av kockgenen i stället kodad ACCACGTGGAAGAAAGGAAACCATGCAACGTCGATA, som ger upphov till mer mjölkbaserad mat, medan den tidigare varianten ACCACGTGGAAGAAGAGAAACCATGCAACGTCGATA ger mer upphov till billigare husmanskost som säljer bra till vanligt folk.

Nåväl Asta-Agdas Janssonsgener hade i tidigare generationer givit upphov till Janssons frestelse men även fjällbrynt getost, och renskav så Asta-Agda och Carl-Gustaf inspirerade varandra genom drömska berättelser om tystlåtna norrländningar vilka tyst stodo och fnyste i förakt emot fallvindar med orkanstyrka, tillika vinterstormar om -30°C, samt exotiska lyckliga samer vilka jojkade i sin kåta från morgon till kväll. Då Bert-August även hade restauranger i det berömda Piteå, eller "Pitä", som det mer korrekt skall kallas, övertalade Carl-Gustaf sin fader att få basa över den nordligaste restaurangen i denna civilisationens utpost mot ylande vargar och isande vinterstormar uppe i denna midvintersolståndets eviga norrskensflammande utmark.

När nu de nygifta Carl-Gustaf och Asta-Agda Brylé hade installerat sig i Pitä, så började deras storartade matkarriär uppe i detta karga landskap befolkat av urkrafter, vilka inte brydde sig nämnvärt åt bögiga finesser såsom bourdeauxvin och paté, utan skulle ha sitt skurna fläsk och en bira för att inte gruffa.

Maträtter[redigera]

Före Carl-Gustafs och Asta-Agdas emigration till dessa naturens och verklighetens trakter ansågs det av Brylé AB:s ekonomiingenjör att Pitä-restaurangen endast var ett kommersiellt experiment i att pröva nya marker och marknader, men efter våra såta ungdomars experimentella verksamhet blev Pitä-restaurangen en avdelning i sin egen rätt och en stor kassasko som skulle komma att föda generationer av Bryléer samt över dessa ösa lyx och flärd.

Nå hur som helst så satte Carl-Gustaf, bistådd av sin fru Asta-Agdas råd att skyffla om saker på matmenyerna, samt införa mer verklighetsanpassad mat, bland annat tog man bort de så uppenbart malplacerade Biff Chop Suey, Escargots samt kycklinglever och Smörstekta sniglar, och bytte ut dessa mot salt strömming, salt korv samt nybryggt öl. Efter en hel del experimenterande kom det unga paret fram till att de köldhärdiga norrlänningarna behövde massor med fett och proteiner i maten, varför man konstruerade Pitepalten, det som senare givit staden namnet Pitepalteå, man kryddade med den narkotiska kryddan koma, och fick således fram ett glatt och bedövat tillstånd hos traktens arbetare som till sina arbetsgivare arbetssamt och utan klagan plötsligt började arbeta hårdare. Denna serverades med fläsk och extraordinärt sötad lingonsylt, vilket fick detta nordliga folk att bli så arbetssamma att de svettades vid -10°C. Vidare komponerades med stor omsorg de snarlika maträtterna blodpudding med fläsk och extraordinärt sötad lingonsylt. Olika varianter av lever med extraordinärt sötad lingonsylt serverades även på Brylé AB:s varför Brylé-restaurangerna blev oerhört populära. En ingift svåger till Asta-Agda framställde nu även surströmmingen, vilket uppskattades storligen av de kärva naturfolket däruppe, då det var väl kryddat, och inte förlorade smaken ens vid mycket stora mängder brännevin, vilket generellt användes som törstsläckare uppe i landsdelen.